86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pmc11280363-36-11-21?v=GenScript+corporation Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
DBI Bioscience
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix Specific Forward Primer And Reverse Primer Using Bestar Sybrgreen Qpcr Mastermix, supplied by DBI Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pm40468088-37-41-45?v=DBI+Bioscience Average 90 stars, based on 1 article reviews
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Johns Hopkins HealthCare
forward and reverse primers Forward And Reverse Primers, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pmc01924773-55-20-13?v=Johns+Hopkins+HealthCare Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
ef1a forward and reverse primers Ef1a Forward And Reverse Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pm36931269-383-9-19?v=Microsynth+ag Average 90 stars, based on 1 article reviews
ef1a forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
forward and reverse primers Forward And Reverse Primers, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pm26438311-76-65-67?v=GenScript+corporation Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
G Biosciences
forward and reverse primers Forward And Reverse Primers, supplied by G Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pmc10718815-104-24-29?v=G+Biosciences Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
custom forward and reverse primers Custom Forward And Reverse Primers, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pmc01400613-34-31-50?v=GeNOsys+Inc Average 90 stars, based on 1 article reviews
custom forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Inqaba biotec
5’-tailed m13 forward and reverse primers 5’ Tailed M13 Forward And Reverse Primers, supplied by Inqaba biotec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/10__5897_slash_ajb2016__15678-82-29-30?v=Inqaba+biotec Average 90 stars, based on 1 article reviews
5’-tailed m13 forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
forward and reverse primers Forward And Reverse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/10__18805_slash_ag__d___6103-46-28-30?v=Metabion+International+AG Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
16s igf (forward) 16s igr (reverse) primers 16s Igf (Forward) 16s Igr (Reverse) Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pm35019255-226-28-38?v=Microsynth+ag Average 90 stars, based on 1 article reviews
16s igf (forward) 16s igr (reverse) primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
forward primers Forward Primers, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/forward+reverse+primers/pmc08012551-101-2-7?v=TIB+MOLBIOL Average 90 stars, based on 1 article reviews
forward primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |