forward reverse primers Search Results


86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
GenScript corporation gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′)
Gapdh (Forward Primer: 5′–Aatcccatcaccatcttcca–3′; Reverse Primer: 5′–Tggactccacgacgtactca–3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pmc11280363-36-11-21?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
gapdh (forward primer: 5′–aatcccatcaccatcttcca–3′; reverse primer: 5′–tggactccacgacgtactca–3′) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
DBI Bioscience specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix
Specific Forward Primer And Reverse Primer Using Bestar Sybrgreen Qpcr Mastermix, supplied by DBI Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pm40468088-37-41-45?v=DBI+Bioscience
Average 90 stars, based on 1 article reviews
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare forward and reverse primers
Forward And Reverse Primers, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pmc01924773-55-20-13?v=Johns+Hopkins+HealthCare
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Microsynth ag ef1a forward and reverse primers
Ef1a Forward And Reverse Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pm36931269-383-9-19?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
ef1a forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation forward and reverse primers
Forward And Reverse Primers, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pm26438311-76-65-67?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
G Biosciences forward and reverse primers
Forward And Reverse Primers, supplied by G Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pmc10718815-104-24-29?v=G+Biosciences
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GeNOsys Inc custom forward and reverse primers
Custom Forward And Reverse Primers, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pmc01400613-34-31-50?v=GeNOsys+Inc
Average 90 stars, based on 1 article reviews
custom forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Inqaba biotec 5’-tailed m13 forward and reverse primers
5’ Tailed M13 Forward And Reverse Primers, supplied by Inqaba biotec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/10__5897_slash_ajb2016__15678-82-29-30?v=Inqaba+biotec
Average 90 stars, based on 1 article reviews
5’-tailed m13 forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Metabion International AG forward and reverse primers
Forward And Reverse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/10__18805_slash_ag__d___6103-46-28-30?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Microsynth ag 16s igf (forward) 16s igr (reverse) primers
16s Igf (Forward) 16s Igr (Reverse) Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pm35019255-226-28-38?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
16s igf (forward) 16s igr (reverse) primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
TIB MOLBIOL forward primers
Forward Primers, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/forward+reverse+primers/pmc08012551-101-2-7?v=TIB+MOLBIOL
Average 90 stars, based on 1 article reviews
forward primers - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results